In an earlier posting, I promised to provide an overview of alternative codes in DNA. Such examples include alternative splicing and alternative reading frames (ARFs) which I will discuss here
The classical view of DNA was straightforward, DNA gets transcribed into RNA, introns get removed and the resulting exons form a protein. Exons are coding sequences in genes, introns are pieces of DNA/RNA that interrupt exons. The first step involves RNA synthesis (transcription) where the DNA is transcribed into RNA and exons and introns are still present, the next step is RNA splicing where introns are being removed. Alternative splicing causes different exons to be combined into messenger RNA (mRNA). These mRNA are translated into proteins in a step called protein synthesis.
Alternative splicing involves different exons and result in different proteins from the same gene
![]()
Source: The New Genetics NIH Publication No. 07-662
Alternative reading frames (ARFs) are overlapping stretches of DNA which encode for different proteins. Alternative reading frames are offset +1 or +2 and read in the same direction.
In general there are 6 reading frames
Once the RNA has been transcribed, it travels from the DNA template to the ribosome on the endoplasmic reticulum to be translated for protein synthesis. Each 3 bases in the RNA sequence codes for 1 amino acid. As you may not be sure what position to start at when predicting what protein sequence may be produced by this code, you could start with one of 3 positions from either end of the RNA sequence. Thus there are 6 possible predicted protein sequences resulting from such a piece of code. These are known as the 6 possible reading frames. There are 3 forward frames and 3 reverse sense frames.
Let’s perform an example
Assume you have just found a new stretch of DNA and you need to determine where to find an Open Reading Frame (ORF). An open reading frame starts with an atg (Met) in most species and ends with a stop codon (taa, tag or tga).
5’ TCAATGTAACGCGCTACCCGGAGCTCTGGGCCCAAATTTCATCCACT 3’
There are six possible interpretations, from right to left and left to right and with an offset of 0, 1 and 2.
Biology WorkBench is a tool which allows you to enter DNA sequences and find the ORF which has the longest frame.
Frame 1 start from left to right with zero offset
S M * R A T R S S G P K F H P
tcaatgtaacgcgctacccggagctctgggcccaaatttcatccact
Note the atg which is a start codon and taa which is a stop codon
Frame 2, offset 1
Q C N A L P G A L G P N F I H
caatgtaacgcgctacccggagctctgggcccaaatttcatccact
No start or stop codon
Frame 3, offset 2
N V T R Y P E L W A Q I S S T
aatgtaacgcgctacccggagctctgggcccaaatttcatccact 47
No start or stop codon
Frame 4, right to left zero offset
S G * N L G P E L R V A R Y I
agtggatgaaatttgggcccagagctccgggtagcgcgttacattga
One stop codon, no start codon
Frame 5, right to left one offset
V D E I W A Q S S G * R V T L
gtggatgaaatttgggcccagagctccgggtagcgcgttacattga
One stop codon, no start codon
Frame 6, right to left two offset
W M K F G P R A P G S A L H *
tggatgaaatttgggcccagagctccgggtagcgcgttacattga
The sixth ORF is the longest one.
In “A First Look at ARFome: Dual-Coding Genes in Mammalian Genomes”, Chung et al, show that dual coding genes are not as rare in mammals as initially expected.
Coding of multiple proteins by overlapping reading frames is not a feature one would associate with eukaryotic genes. Indeed, codependency between codons of overlapping protein-coding regions imposes a unique set of evolutionary constraints, making it a costly arrangement. Yet in cases of tightly coexpressed interacting proteins, dual coding may be advantageous. Here we show that although dual coding is nearly impossible by chance, a number of human transcripts contain overlapping coding regions. Using newly developed statistical techniques, we identified 40 candidate genes with evolutionarily conserved overlapping coding regions. Because our approach is conservative, we expect mammals to possess more dual-coding genes. Our results emphasize that the skepticism surrounding eukaryotic dual coding is unwarranted: rather than being artifacts, overlapping reading frames are often hallmarks of fascinating biology.
Remember this paper which was quote-mined by Casey Luskin?
The paper shows the following figure (click to enlarge) which is Figure 2 in the original paper)
Notice how there is and ORF and an ARF, where ORF is the larger reading frame and ARF a subset, both ORF and ARF have a start and stop codon.
Addition
The ENCODE project proposes a new definition of gene
Figure 5. How the proposed definition of the gene can be applied to a sample case. A genomic region produces three primary transcripts. After alternative splicing, products of two of these encode five protein products, while the third encodes for a noncoding RNA (ncRNA) product. The protein products are encoded by three clusters of DNA sequence segments (A, B, and C; D; and E). In the case of the three-segment cluster (A, B, C), each DNA sequence segment is shared by at least two of the products. Two primary transcripts share a 5 untranslated region, but their translated regions D and E do not overlap. There is also one noncoding RNA product, and because its sequence is of RNA, not protein, the fact that it shares its genomic sequences (X and Y) with the protein-coding genomic segments A and E does not make it a co-product of these protein-coding genes. In summary, there are four genes in this region, and they are the sets of sequences shown inside the orange dashed lines: Gene 1 consists of the sequence segments A, B, and C; gene 2 consists of D; gene 3 of E; and gene 4 of X and Y. In the diagram, for clarity, the exonic and protein sequences A have been lined up vertically, so the dashed lines for the spliced transcripts and functional products indicate connectivity between the proteins sequences (ovals) and RNA sequences (boxes). (Solid boxes on transcripts) Untranslated sequences, (open boxes) translated sequences.
Mark B. Gerstein, Can Bruce, Joel S. Rozowsky, Deyou Zheng, Jiang Du, Jan O. Korbel, Olof Emanuelsson, Zhengdong D. Zhang, Sherman Weissman, and Michael Snyder What is a gene, post-ENCODE? History and updated definition Genome Res., Jun 2007; 17: 669 - 681.
Thanks for bringing this topic up PvM But To give a little more background to the Complexity of Human Genome let’s look at the ENCODE work:
In a group paper published in the June 14, 2007 issue of Nature and in 28 companion papers published in the June issue of Genome Research, the ENCyclopedia Of DNA Elements (ENCODE) consortium, which is organized by the National Human Genome Research Institute (NHGRI), part of the National Institutes of Health (NIH), reported results of its exhaustive, four-year effort to build a parts list of all biologically functional elements in 1 percent of the human genome. Carried out by 35 groups from 80 organizations around the world, the research served as a pilot to test the feasibility of a full-scale initiative to produce a comprehensive catalog of all components of the human genome crucial for biological function. The ENCODE consortium’s major findings include the discovery that the majority of DNA in the human genome is transcribed into functional molecules, called RNA, and that these transcripts extensively overlap one another. This broad pattern of transcription challenges the long-standing view that the human genome consists of a relatively small set of discrete genes, along with a vast amount of so-called junk DNA that is not biologically active. The new data indicate the genome contains very little unused sequences and, in fact, is a complex, interwoven network. In this network, genes are just one of many types of DNA sequences that have a functional impact. The revelation of a complex interwoven network is a major blow to evolutionists. Now bear in mind, this is only a “feasibility study” of 1% of the Genome. The interwoven complexity is sure to be multiplied exponentially as the effort extends to decipher the remaining 99% of the DNA. This preliminary study, of how DNA is actually encoded, clearly indicates that most, if not the entire 100%, of the DNA is “poly-functional”. Poly-functional simply means the DNA exhibits extreme data compression in its character. “Poly-functional” DNA sequences will exhibit several different meanings on several different levels. For instance, if you were to write a (very large) book similar to the DNA code, you could read many parts of the book normally and it would have one meaning, you could read the same parts of the book backwards and it would have another completely understandable meaning. Yet then again, a third equally coherent meaning would be found by reading every other letter of the same parts. A fourth level of meaning could be found by using a simple encryption program to get yet another meaning. A fifth and sixth level of meaning could be found in the way you folded the parts of the book into specific two and three dimensional shapes. Please bear in mind, this is just the very beginning of the mind bending complexity scientists are finding in the DNA code. Indeed, a study by Trifonov in 1989 has shown that probably all DNA sequences in the genome encrypt for up to 12 different codes of encryption!! No sentence, paragraph, book or computer program man has ever written comes close to that staggering level of poly-functional encryption we find in the DNA code of man. Here is a quote on the poly-functional nature of the DNA from renowned Cornell Geneticist and inventor Dr. John Sanford from his landmark book, “Genetic Entropy”: There is abundant evidence that most DNA sequences are poly-functional, and therefore are poly-constrained. This fact has been extensively demonstrated by Trifonov (1989). For example, most human coding sequences encode for two different RNAs, read in opposite directions i.e. Both DNA strands are transcribed ( Yelin et al., 2003). Some sequences encode for different proteins depending on where translation is initiated and where the reading frame begins (i.e. read-through proteins). Some sequences encode for different proteins based upon alternate mRNA splicing. Some sequences serve simultaneously for protein-encoding and also serve as internal transcriptional promoters. Some sequences encode for both a protein coding, and a protein-binding region. Alu elements and origins-of-replication can be found within functional promoters and within exons. Basically all DNA sequences are constrained by isochore requirements (regional GC content), “word” content (species-specific profiles of di-, tri-, and tetra-nucleotide frequencies), and nucleosome binding sites (i.e. All DNA must condense). Selective condensation is clearly implicated in gene regulation, and selective nucleosome binding is controlled by specific DNA sequence patterns - which must permeate the entire genome. Lastly, probably all sequences do what they do, even as they also affect general spacing and DNA-folding/architecture - which is clearly sequence dependent. To explain the incredible amount of information which must somehow be packed into the genome (given that extreme complexity of life), we really have to assume that there are even higher levels of organization and information encrypted within the genome. For example, there is another whole level of organization at the epigenetic level (Gibbs 2003). There also appears to be extensive sequence dependent three-dimensional organization within chromosomes and the whole nucleus (Manuelides, 1990; Gardiner, 1995; Flam, 1994). Trifonov (1989), has shown that probably all DNA sequences in the genome encrypt multiple “codes” (up to 12 codes). Dr. John Sanford (PhD in Genetics; inventor of the biolistic “gene gun” process! Holds over 25 patents! If you ate today you probably ate some food that has been touched by his work in manipulating the genetics of food crops!) Though the ENCODE consortium is about to undertake the task of deciphering the remaining 99% of the humane genome, I firmly believe that they, and all their super-computers, are soon to be dwarfed by the sheer and awesome complexity at which that much required information is encoded into the three billion letters of the DNA code of man. As a sidelight to this, it takes the most powerful super-computer in the world an entire year just to calculate how a single 100 amino acid protein sequence will fold into a 3-dimensional shape from its 1-dimensional starting point. Needless to say, this impressive endeavor by ENCODE to decipher the entire genome of man will be very, very interesting to watch. Hopefully ENDODE’s research will enable doctors to treat a majority of the over 3500 genetic diseases (mutational disorders) that afflict man without having to fully understand that much apparent complexity in the DNA of man.
How’s that for a Theistic prediction for ID?
It’s neither a prediction nor relevant to ID. So let’s address some of your misconceptions. These multiple coding levels in DNA are in many cases neither unexpected, nor a problem for evolutionary theory. Now I understand that complexity may seem to ID creationist to be an insurmountable problem, but that does not mean that these are problems for evolutionary theory.
For instance, the alternative splicing allows new proteins to be encoded without affecting the original protein. In other words, just like gene duplication, alternative splicing allows new information to be added to the genome. In fact, research already suggests some correlations between gene duplication and alternative splicing.
Gene duplication is not only an excellent source of new genetic information but also lies at the foundation of the evolution of scale free networks. Scale free networks are both robust and highly evolvable. Sounds contradictory doesn’t it. Science however has shown that contrary to ‘common sense’ the ‘devil’ is in the details.
Sanford’s book is neither a landmark book nor particularly relevant and cut-and-pasting your comments does not help you case. Yes, in addition to these alternative reading and splicing, there are other ways to add information to the genome. Of course, you nor Sanford have really shown that this is a problem and I have shown in several comments and postings how these multiple levels of coding hardly need to be problematic.
Are you willing to discuss these findings or is this yet another hit and run posting?
Is that the Christian way to resolve these issue?
As Carporale explains
It is the degeneracy of the genetic code which allows the genetic code to carry additional information. In other words, the degeneracy which provides robustness to the genome also provides for evolvability.
I do not yet have access to the Trifonov 1998 paper (do you?) but I have found a very similar paper
E. N. Trifonov Interfering contexts of regulatory sequence elements Bioinformatics Volume 12, Number 5 Pp. 423-429, 1996
PS: When you mention that DNA can encode for up to 12 different codes, one should make it clear that these 12 different codes seldomly occur for the same stretch of the genome. Actually, the overlap of codes was an evolutionary prediction made in 1968 by Holliday. Doolittle used the term ‘molecular opportunism’ to describe crystallins (eye lens proteins) which serve as different enzymes in different tissues, unrelated to the eye…
If I follow PvM’s post correctly, the whole multiple codes stuff is perfectly consistent with evolution but NOT with ID. ID chaps are always inferring by analogy, particularly to human design and human programs - and humans don’t write code like DNA. We write lines that have a single meaning. A blind process, however, that is simply picking up bits of code that it finds improves itself, would have no problem with picking up a dual coding system.
Of course, anything is consistent with ID since it predicts really nothing. If however ID is that which cannot be explained by evolutionary theory then it is clear that these multiple codes are not really relevant to ID since it neither explains them nor can it prevent science from exploring explanations.
In the end, all it comes down to is: Look at this ‘complexity’ which needs an explanation, and the ‘best’ explanation is ‘design’, whatever that may mean. As I have shown, design has no real meaning in ID either, only through conflation can ID pretend to have a case.
See addition to my original posting for ENCODE’s perspective
I just wanted to say that in terms of evolution it doesn’t even have to be an improvement for that “pick-up” to remain, it just can’t be too detrimental. An important distinction frequently overlooked.
While this doesn’t address BornAgain77’s post directly, it would be nice if he would better identify which sections of his post were original, rather than plagiarized.
For example, his comment block:
Comes directly from here: http://www.cbse.ucsc.edu/news/2007/[…]/index.shtml
BornAgain77 identifies himself as a born again, therefore it is natural for him to lie and plagerize, that’s what a good Christian does. Quite simple, really. Irember one christian that didn’t lie, but he died.
Yes, such as near-neutral mutations or detrimental mutations which can become fixated by chance in small populations.
Understanding that evolution includes a multitude of effects makes speaking of neutral and beneficial only mutations evolving, a caricature of evolutionary science. Sadly enough, creationists will quickly quote mine this to show that evolution is devolution
I respectfully disagree with you PvM,
Contrary to what you now seem to be claiming, Evolutionary thought was completely blindsided by the revelation that the genome carries very little unused sequences,,,for you to deny that this was/is very problematic to RM/NS is, to put it mildly, glossing over a severe mis-prediction of the Darwinian camp…Whereas, you well know, many prominent IDers predicted that the junk DNA would be found to have function! Indeed,,the level of complexity even surpassed many ID proponents predictions and really only fits into the specific Theistic predictions made for ID… As for myself, I remember very well being chastised by your guest on this very blog, last spring, for predicting that the genome would be found to have virtually 100% functionality!!! (I was pressed by one of your guest for a specific prediction that ID makes and I quoted 100% functionality!) I was vindicated in short order when the ENCODE paper came out a short while later.
Your are a good PR man with a lot of talent for spin PvM, and I’m sure you will find a way to deny that Intelligence is required to explain this complexity in the Genome.… But believe me when I predict this following prediction PvM…The complexity that will be found in the remaining 99% of the genome will far, far surpass in complexity what we are looking at right now!!!!!!! If you are a betting man PvM, this is sure money, so if I were you I would hedge my bets against any of your evolutionary predictions!!!! You don’t want to be burned this badly again!
By the way…I’m not perfect by any means…Just forgiven!!!
And yet, they can not explain why the pufferfishes of the family Tetraodontidae have been so successful with so little “Junk DNA”
Again, the predictions of junk were not Darwinian predictions as much as explanations leading neutralists to make their claims. Were the findings of ENCODE surprising, sure, I believe that the work showed that increased scientific scrutiny will help us better understand what is going on.
Btw, I assume that you are also familiar with the pseudogenes detected by the ENCODE project. Since you seem to be so enamoured by its findings, I am sure you can appreciate these evolutionary relics.
Nonsense. ID never predicted complexity. Complexity in ID speak is a measure of ignorance. Did you not know? As to theistic predictions, they lack any scientific foundations. While theists may find the fact that less of the genome is junk, the presence of pseudogenes and other junk still seems to bother them. But why…
Again you are wrong, the ENCODE paper does not claim 100%
Again, anyone familiar with the science will know that many of these were predicted by evolutionary science. It was evolutionary science which discovered these additional levels of encodings, it was evolutionary science who is using these new data to show how evolution happened. Remember the Cambrian? It now seems that it was the existence of hox genes, duplication of said hox genes and the evolution of regulatory genes which is the best explanation for the Cambrian. Since the early 90’s much has changed that allows science to explain the Cambrian explosion. You would not get this from reading ID literature.
I myself have been looking at neutrality, evolvability and scale free networks for more than a decade now and it pleases me to find that science is uncovering more and more that the many networks in nature are indeed scale free, and share similar motifs. This shows not only a common origin/process but also helps understand why evolution has been so succesful. Complexity, as found in the genome is indeed fascinating, but lets not confuse the term complexity with how ID uses it.
Surely you are familiar with ID’s definition of complexity? Or are you? Will you finally present us with what you believe is the definition of complexity in ID speak?
In the mean time, science has shown how evolutionary theory explains the evolution of complexity and information in nature. What has ID done so far? Other than claiming it made ‘predictions’ where these predictions are not only oversold but also have little or no relevance to the foundations of ID. As far as complexity being a prediction of theism, I find that hard to believe, since simplicity is the virtue of a good designer.
Does that mean you can lie and misrepresent without repercussion? Is that what Born Again really means?
You claim I am a good PR person, and while I appreciate your flattery, the truth is that I am a far better science person. I try to familiarize myself with the science as well as the musings of ID. Based on the limited original contributions by you as well as some continued ignorant comments about evolution, I seem to be safe to conclude that your understanding of evolution is shaped by such sites as AIG and other anti-science sites. See the problem is not that AIG is anti-science, but rather that they like ID are trying to sell their nonsense as science. As such they make Christians look foolish and people will reject Christians’ claims about their faith as foolish as well.
Is that what you have in mind? You have been forgiven and nothing else matters? Do you really believe that such a position serves God best?
Why not amaze yourself, others and God with a true attempt at educating yourself. And I am saying this in the nicest way since I am convinced that your ignorance is not by your own chosing. As an ex Young Earth Creationist, I used to be much like you, convinced by the righteousness of my fellow Christians, only to find out how I had been lied to.
Let’s try this once more and see if you can learn or at least educate yourself. Explain how ID defines complexity, explain how ID defines ‘design’.
Simple or at least important concepts and still I bet you have no idea how ID deals with them.
Yes, Jesus died for James Bond so James can embrace and masturbate to his own ignorance and call that “faith.”
A quick trip in history shows that for instance Trifonov understood that DNA has many different ‘codes’. He was hardly unique here, as he was reviewing ‘current’ knowledge at that time. Trifonov himself referenced the work by Holliday, 1968.
All ENCODE did was to show that these codes were more pervasive than previously thought. Simple genes became open reading frames became introns and exons became alternative reading frames, alternative splicing. Genes became regulatory genes,
Since you read the ENCODE papers, you surely are familiar with the timeline
A lovely 2001 review article by Mattick et al argues
BJ Bond wrote:
“By the way…I’m not perfect by any means…Just forgiven!!!”
NOT BY ME!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
That appears to be loosely analogous to subroutines in computer code.
Henry
PvM,
You patience is Christian is scope. Thank you for your clear refutations of the sad troll BJB.
rog
Thanks, you know, the good thing about rebutting anyone is that it allows me to learn so much new exciting topics. Remember I am not an expert in these matters, just someone who reads a lot and understands a bit.
PvM, I’m curious about your YEC background.
I’d be interested to here what made you leave it behind. Was there something specific that made you reject YECism or was it a slow process? Did people around you react negatively to your rejection of YECism?
If this is covering old ground or it’s too personal, then apologies in advance.
So, this breaks down the potential human intelligence analogy since most computer code is relatively straightforward and imperative, note interleaved and interpretative (in sense that same sequence can be read differently with different results)?
Than equivocation between human design and DNA is absolutely false?
Interesting references PvM
Of special note;
Eukaryotic phenotypic diversity arises from multitasking of a core proteome of limited size. Multitasking is routine in computers, as well as in other sophisticated information systems, and requires multiple inputs and outputs to control and integrate network activity.
Big glitch in reasoning in this remark,,as it is with all your other references,,,He PRESUMES that evolution is true and then goes about to prove it…This is clearly the practice of very bad science when he presumes the answer prior to investigation! I’m sure I don’t have to remind you of the lack of evidence for beneficial mutations (Including your highly touted HOX genes!) If you can find some observational evidence showing the origination of complexity, instead of degradation of preexisting genomes of parent species, this might be more impressive for IDers!
I find his reference to computer programs very interesting…How many computer programmers do you think,,think it is possible for a computer program, that far, far surpasses in complexity any computer program written in man (Bill Gates), to arise by accident?
Not many I would think,,,But hey ..Like I said earlier you are very good at spin,,,so I’m sure you can sell it to the gullible!
By the way Stanton,,, Though I don’t mean to sound rude to you,,,It is definitely not you that I am worried about receiving forgiveness from!!
Given as how you are a smug, arrogant idiot, I have no reason to give you any forgiveness in the first place: in fact, I make it a point to dislike people who use their faith in God act like Godless assholes.
Can you explain why IDiots have not explained why pufferfish have survived and prospered so well without Junk DNA, or can you not find any sites to copy and paste from?
B,JB,BA77 said:
“I respectfully disagree with you PvM,
Contrary to what you now seem to be claiming, Evolutionary thought was completely blindsided by the revelation that the genome carries very little unused sequences,,,for you to deny that this was/is very problematic to RM/NS is, to put it mildly, glossing over a severe mis-prediction of the Darwinian camp…Whereas, you well know, many prominent IDers predicted that the junk DNA would be found to have function!”
Maybe he should read this paper:
Nobrega MA, et al. Megabase deletions of gene deserts result in viable mice. Nature 2004; 431:988-993.
This study deleted 845 thousand bases and 1.5 million bases from mESC (2). The deleted regions, known as “gene deserts” are devoid of protein coding sequences and are what has been referred to as “junk DNA”. Thus, deleting these segments in the embryonic stem cell line will result in adult mice (if they survive) lacking these segments of the genome (homozygous deletions) in all of their cells. If these sequences are necessary for building and maintaining the adult mouse, these deletions should be lethal or greatly affect the phenotype compared to wild-type. The results, you ask? Well, the mice were “indistinguishable from wildtype littermates with regard to morphology, reproductive fitness, growth, longevity, and a variety of parameters assaying general homeostasis.” They conclude, “these studies further support the existence of potentially ‘disposable DNA’ in the genome of mammals.”
So, large stretches can be deleted without obvious phenotypic effects in mammals, at least mice. Also, saying that ““junk DNA” will be found to have some function” is different than predicting an actual function and discovering it. Also, in what way would functionality of “junk DNA” somehow provide evidence that we were supernaturally created?
Don’t worry, JM, James Bond will think of something to plagiarize in response, eventually.
Ridlon and Stanton, How much do you want to bet that genetic diversity and/or overall viability/fitness of the offspring of such “knockout mice” is indeed limited and noticeable as far as the diversity and viability/fitness that is present in the parent species? My bet is that it will definitely be less than the parent species!..For example, I could remove major portions of a car and still have a car that performed its basic functions, Yet it would suffer in other areas noticeable areas when rigorously tested!…Thus, this example is a lot different than proving that the genome that was removed is absolutely and totally useless in its overall fitness in life! Plus, as someone mentioned before, I’m enamored by ENCODE! .…The ENCODE consortium’s major findings include the discovery that the majority of DNA in the human genome is transcribed into functional molecules, called RNA, and that these transcripts extensively overlap one another.…
Thus I have hard scientific evidence that the majority of the Genome does indeed have some type of unknown function! Whereas, you have a superfluous example (an example by the way, which actually may be a very useful diagnostic technique in studying the genetic diseases of man) in which you claim absolutely no function is present in genome, for large swaths of the genome were removed and BEHOLD THE MICE LIVE!!!) Excuse me for being underwhelmed by your evidence for the non-functionality of the genome!
BJ Bond wrote:
“By the way Stanton,,, Though I don’t mean to sound rude to you,,,It is definitely not you that I am worried about receiving forgiveness from!!”
Obviously!!!!!!
This is the problem with holier-than-thous. They lie and insult people deliberately, repeatedly and unrepentenly and then claim that their conscience is clear because God forgives them. Well BJ, I would be more than happy to forgive you if you would just respond to some of my questions. I would be more than happy to forgive even your immense ignorance if you at least showed the slightest inclination to read the real scientific literature. I would even be willing to forgive your arrogance and condescending tone if you were willing to engage in some meaningful conversation instead of cut-and-paste nonresponses. You claim that you don’t mean to be rude, but how can such behavior reasonably be interpreted in any other way?
And by the way, I am not “Stanton”. I am using the name “David Stanton” exclusively. This does not however imply that I disagree with the postings of “Stanton” in any way. It just means that I use one handle consistently, unlike yourself. And just for the record, using the name of someone with a lisence to kill and claiming divine forgiveness is almost as hypocritical as claiming that you have all of the answers and not even bothering to read the relevant literature.
“The ENCODE consortium’s major findings include the discovery that the majority of DNA in the human genome is transcribed into functional molecules, called RNA, and that these transcripts extensively overlap one another.”
Reread the paper, there were something like 120 pseudogenes, 19% of which were expressed. Many RNA’s were expressed, but whether they are indeed “functional” is another matter. This can not be determined from the ENCODE data.
Also, you were “underwhelmed” by this data? The mice didn’t just live. I will repeat, “[the knockout mice]indistinguishable from wildtype littermates with regard to morphology, reproductive fitness, growth, longevity, and a variety of parameters assaying general homeostasis.”
Bond then said: “For example, I could remove major portions of a car and still have a car that performed its basic functions, Yet it would suffer in other areas noticeable areas when rigorously tested!…”
The point of this study was that “major portions” were not removed. You can bet all you want, but the fact is that these mice appeared completely normal. In the end, this DNA was not necessary for a mouse to develop to adulthood and live a normal life.….it was “junk DNA”.
Except when you don’t of course such as in
Nope. There you go again…
Nope, that’s thrown together by regularity. It’s a simple fact that the genetic code can have six different interpretations. Surely you are familiar with this basic fact? If not, study how science unraveled the genetic code.
Where did I deny intelligence in nature (other than perhaps doubting yours?)
You just said it again, realpc. Thrown together by chance. In your case you’re a troll and just pretending stupidity to bait people (or you wouldn’t repeat the nonsense about parallel universes, which isn’t even slightly connected to evolution, after being corrected - and I note also, like all creationists, you didn’t explain that point, you probably just threw it in there because it causes doubt), but sadly, genuinely stupid creationists also do this - even on UD, where the phrase ‘chance worshippers’ often appears. It’s a strawman, no better than the stupid tornado-in-a-junkyard (but hey, don’t take OUR word that ID is creationism recycled).
If you have an alternative explanation than ‘creationists are too stupid to learn’ or ‘creationists are too dishonest to tell the truth’, feel free to drop it here.
“the nonsense about parallel universes, which isn’t even slightly connected to evolution”
Of course it is. Parallel universes are used to explain how utterly unlikely things can nevertheless happen. The origin of life and the origin of new species are problems for MET. The parallel universe idea is used to explain away the origin of life. It had to happen, given an infinite number of universes. EVERYTHING had to happen, no matter how impossible.
And yes, the origin of life is a problem for MET. If you are claiming that intelligence is something generated by brains, and is not a property of nature in general, then you MUST believe life originated by chance. And if you have no plausible theory about how this could happen, then the contempt you express for ID is not justifiable.
Only a few problems here. Intelligence is likely to be a property of nature, in the sense that it can be reduced to regularity and chance. But I still fail to see how you reached your conclusion.
Origin of life is a problem for science mostly because we know so little about it, however, as any cursory look at the scientific literature shows, our ignorance while still vast, is quickly diminishing in some very relevant areas.
The real problem is for ID which, in case of multiverses, stands no chance because it cannot even exclude pure chance. But even in a singular universe, ID stands no chance since science provides some tentative hypotheses. And ID has nothing to offer.
Since the existence of multiverses follows from the same cosmological theory which has been quite successful, it is scientific to explore its impact.
I believe to correctly understand Koonin’s papers, he addresses both regularity and chance hypotheses, the existence of either one is sufficient to undermine the ID hypothesis. While the multiverse approach fully disables ID, the regularity approach (or perhaps regularity and chance) approach in the Wolf and Koonin paper shows the scientific vacuity of ID.
Nothing other than basic semantics is needed to explain how utterly unlikely things can nevertheless happen – the distinction between “utterly unlikely” and “impossible” is precisely that the former “can nevertheless happen”. And by basic probability arithmetic, the likelihood of possible but individually unlikely events assymptotically approaches 1 as the number of trials increases. And if the later occurrence of events is not unrelated to the prior occurrence of events, the approach may be far faster than if the events are mutually independent.
a) No one claims that everything had to happen – that’s a stupid strawman. b) There are no degrees of impossible – you are a stupid person.
Intelligence isn’t “generated”, it’s a property of goal-seeking systems, and characterizes how effective the system is in reaching its goals. Brains are not the only goal-seeking systems, nor are they the only goal-seeking systems that could possibly be characterized as “intelligent”. And of course not all brains can be characterized as intelligent – consider yours, for instance.
That would be a radical category mistake.
Non sequitur, but in any case, so what?
“It happened by chance” is plausible, especially when “it” hat not been precisely specified and the probability of “it” happening has not been calculated, but lacks detail – the sort of detail science seeks.
This, like any ad hominem argument, is a non sequitur. The validity of the arguments against ID have nothing to with whether Pim or anyone else has a plausible theory for something or other.
It’s not obvious, it’s the result of huge amounts of work by many scientists over many decades.
intelligencedidit isn’t science.
Events with a non-zero probability will have an infinite number of occurrences over infinite time. Declaring a tautology to be “irrational nonsense” certainly seems irrational and lacking in intelligence.
RealPC is a very special person.
According to her, Science is really Art.
Claims to have a Phd in something or other.
Oh, and she likes ‘negative theories’.
http://ambivablog.typepad.com/ambiv[…]-random.html
realpc:
As always, abiogenesis isn’t a problem for evolutionary theory because it isn’t part of the theory.
What you are saying is analogous to claiming that not having a good description of how a particular drainage basin is sourced, say the sources of the Nile, is a problem for hydrodynamic theory to explain water flows. Do you see how stupid you look?
And origin of species are explained by evolutionary theory entirely without invoking parallel universes or even unlikely things. Mutation and fixation rates are measurable statistics.
If you ask where parallel universes are discussed, it is usually in cosmology where two independent theories (inflation theory and string theory) predict them independently or in concert.
Another use you can see is that it is easy to explain why creationists conflation between a priori probability and a posteriori likelihoods are wrong. (Though as PG notes, it brings unnecessary baggage for that purpose.) Finally it is used to show why finetunings are natural consequences.
Abiogenesis is chap 1 in a wholly natural evolution of life process. Evolutionists cannot be wholly credible unless they can demonstrate that abiogenesis is actually possible. I don’t think that has been demonstated yet,though obviouly most evolutioninsts believe it is possible.Thus, at present, there is room for other theories. Evolutioninsts should not be so harsh and judgemental about people who are sceptical that something so bizarre and complex as life is a result of spontaneously forming self-reproducing proto-cell gradually mutating into a conscious, thinking, feeling person. And yes, people like realpc and bjb have a right to voice their beliefs, even if they are wrong, without being constantly belittled and insulted. They can read, they can write, i.e. they are not morons, and I see no reason for calling them liars, unless you guys possess supernatural psychic powers and can divine their true beliefs.
Tell us, what theory do you have in mind?
Re “Evolutionists cannot be wholly credible unless they can demonstrate that abiogenesis is actually possible.”
There was a time before which life dind’t exist.
Life exists now.
Therefore life began in a place that had no life before that.
Q.E.D.
Henry
To: pvm. I was referring to ID, although there are others. For ex, DNA structure discoverer, Watson, I think, believes life was seeded by aliens, and I vaguely recall reading something about some sort of self-organization theory in some Santa Fe’s institute. You probably know a lot more about this than I do. I am not a scientist(obviously), and though I always revered science and scientists, and had taken many courses in college, it is the ID/evolution contoversy that I only recently discovered existed, that now makes learning scientific facts exciting for me.
To Henry: what you say is logical, and yet can only be true if we exclude a priory (is this the right spelling?) the influence of some sort of “power” beyond our knowlege or comprehension. The point that I learned from IDists that I found to be a very good one is that life by en large is a mystery. There is a lot we don’t know. To the best of my knowledge life does not self-assemble under various laboratory conditions tried. Whether that’s simply a temporary lack of success, or a result of an actual impossibility, sans the above mentioned “power”, I have absolutely no idea. But it’s fun to speculate.
Nope. What I said doesn’t depend on excluding anything a priory. It holds even if the beginning of life was engineered by a “power”.
Henry
Why? There is no real scientific ID/Evolution controversy. ID merely is the claim that we do not understand all and thus this should be considered to be ‘design’. WHat’s so exciting about that?
Sure, science is exciting but it hardly needs ID to make it so.
Sure, but what else is there to speculate when you admit a supernatural designer? It’s a scientific dead end
Anna:
All scientific theories live and die by the data they describe, no more no less. For example, Newton’s gravity theory was wholly credible, describing how gravity behaves, without being able to describe what gravity is, how it originates.
When general relativity later replaced Newton’s theory, it was because there was types of observations where Newton’s theory predicted wrong. (Strong fields, for example.) But it still doesn’t explain the microscopic fundamental mechanisms that are responsible for gravitation, its quantum nature. This is a task for later theories.
Your claim implies a serious misunderstanding of how science works and what scientific theories are.
We can turn this around - why should evolutionary biology of all sciences be tasked to provide a complete understanding when no other science has to?
And how do you envision how this will be possible? Science works by piecemeal gathering new data and refining the description with new theories replacing old incomplete. How do we jump from no understanding of nature to a complete understanding? Is it even possible to have a complete understanding?
All these are questions you have to provide answer to, if you aren’t satisfied in the way scientists are satisfied. You must answer them and then show that your method of science is better than the current one.
There is always room for other theories, since current theories doesn’t give a complete picture or may be wrong.
Except of course if you believe the task for science is to immediately jump to complete knowledge. Perhaps you even believe in Truth, as opposed to observable facts and predictive theories which is all science can ever provide.
Very funny. :-) They have showed themselves over and over to be reading and writing morons. You can be highly intelligent and still be dysfunctional in many things. And these guys aren’t even close to that.
That’s Francis Crick who went for panspermia.
There’s no ID/evolution controversy in science, only in politics and religion.
It’s spelled “a priori”, and would be italicized in formal writing (I often don’t on the forums either).
And who a priori excludes the influence of a “power” beyond our knowledge or comprehension? Who’s telling the theistic evolutionists that they need to quit worshipping God (I know a few names, but they’re relatively few, indeed)? In other words, quit believing the lies of the IDists. The only reason they tell you that we exclude God or some other designer a priori is that they wouldn’t have anything to complain about if they were simply being honest.
How did you find that to be a good point? You’re no scientist, as you said, and you seem not to know a great deal about it.
Life has a great many mysteries which have not been explained. There is, however, a very good explanation for the hierarchies that we see, for the relationships between organisms (differing between asexual and sexual organisms, btw), for the fossil record, and for why organs, organelles, and biological machines happen to be derived. Just because some egregiously dishonest people tell you otherwise does not make this untrue.
And who is it that is finding out more and more? The hint is, it is not the IDists who are.
Science explains what it can. It does not look at what has not been explained and say that some magic must be responsible, since we don’t know. Hence science explains fossils and living organisms by the highly evident processes of evolution. What is not explained, such as life’s origin prior to evolution, is simply that, the unexplained.
Science does not rule out higher power or anything like that for whatever has not been explained. All it does is to note that it cannot investigate a power for which it has no evidence, and it (as such) sensibly does not speculate beyond the evidence. This is quite unlike ID, which claims that an unknown cause producing unpredictable effects caused life to appear. Such an idiotic claim would be thrown out of court, and in fact has been.
And that is all that ID can do (which would be fine, if they didn’t make unsupported claims of being science). Science has to do something different, at least at the “methods” stage.
Glen D http://tinyurl.com/2kxyc7
welll it was a good article . it has answered several of my questions but if u plzzzz answer one of question ..plzzzzzzzzzzzzzz. i shall really appreciate it . what would u say about one gene one enzyme hypothesis???? doesnt this theory of multiple transcripts negate it??? was that one gene one polypeptide hypoyhesis wrong ??? a gene may form many mRnas i.e it can also form amny polypepptides????? plzzz plzzz reply as soon as possible on my E-mail address.. plzzzz
Update