Take the Intelligent Design Challenge!

| 42 Comments | 4 TrackBacks

Determining where a genome has been produced or altered by an intelligent designer is a matter of some importance. Consider the claims that the HIV virus was engineered as a biowarfare weapon, or the concern that virulence genes from other organisms could be inserted into viruses and bacteria to “weaponise” them. For example the engineered mouse pox virus that turned lethal (Nature. 2001 May 17;411(6835):232-5 see also Nat Genet. 2001 Nov;29(3):253-6) and limits on the sequencing of the 1918 strain of the flu to stop flu from being weaponised (Fed Regist. 2005 Oct 20;70(202):61047-9,). A method that could reliably detect the action of human intelligent design in the genomes of microorganisms would be of significant advantage.

Thus we issue the “Intelligent Design Challenge”. Below the fold are 6 gene sequences. At least one of them has been produced by a human designer. All you have to do is to determine which one(s) have been acted on, what the designed sequence does, and explain the method you used to determine this (in sufficient detail to replicate your determination eg. if you used an approximation of Chaitin information, a brief description of the algorithm you used).

I’ve re-written the contest rules slightly as some people were confused as to what designer they were supposed to detect.

To win, you have to:

1) Identify which sequences have been produced by a human designer
2) Describe how you identified the sequence as being designed (eg. I used PKZip to compress the sequences as an approximation of Chaitin information and ordered the output according to the following criteria etc. etc.)
3) Describe what the sequence does (eg. “This is the active site of a triose phosphate isomerise engineered into a riboprotein – this due to the catalytic triad signature” real example BTW: this isn’t as hard as it sounds once you have the designed sequences)

Obviously, the groups who produced these sequences are not eligible to enter, and if you walked down the corridor and asked the groups who produced these sequences what they did, you are also not eligible. You need to have done some actual work related to the sequences presented here. Simply looking up all journal references to “designed sequences” in Pubmed doesn’t count (obviously this is all public domain, I’m not going to release the engineered killer mousepox virus sequence am I).

If you are in an emergency ward, trying to discover if the superflu screaming through the population is a bioweapon, you won’t find the answer that way. And you won’t have the luxury of having a full viral sequence to BLAST against known genes [thus discovering that the M2 ion channel had been replaced with the amandatine-insensitive Vpu ion channel, so that your antiviral drugs won’t work], but short sequences like the ones above.

Remember, in a real biowarfare situation, everyone will be short of time and resources. A simple, reliable procedure to determine if a sequence has been human-engineered is of the utmost importance.

So, in the spirit of the Robot Soccer Challenge and the NASA Spacecraft Challenge, look at the sequences below the fold and off you go.

The first successful determination of the designed sequence(s) and their function will win a copy of OpenLab 2007.

Comments will be will be opened for your entries at 10:30 pm Australian Central Daylight Saving Time (GMT +10:30), 1 February.

The comments are now live, write in your entries. The first correct answer fulfilling the conditions will receive a copy of OpenLab 2007. As tonight is my sons’ birthday, and I have an occultation to observe as well, don’t expect much input from me for a while.

Sequence 1: attatcacaa aatggtgtga tcttatcaat agcactactt gcttaactag ctaatgtcgt gcaattggag tagagaacac agaacgatta actagctaat ttttttagtt ggatggcaat tgttggaatt cacagctttt tagttggaat tttagttaat catcaaacac ttaaaataag taaaaagtat gttattttag gttcgatttt tccaattatg gcattaacaa atactcttgt

Sequence 2: gatagtagtg ggtggaatag tgaagaaaac gaagctaaaa gtgatgcgcc cctaagtaca ggagggggtg cttcttctgg aacatttaat aaatacctca acaccaagca agcgttagag agcatcggca tcttgtttga tggggatgga atgaggaatg tggttaccca actctattat gcttctacca gcaagctagc agtcaccaac aaccacattg tcgtgatggg taacagcttt

Sequence 3: attatcacaa aatggtgtga tcttatcaat agcactactt gcttttttta gttggatggc aattgttgga attcacagct ttttagttgg aattttagtt aatcatcaaa cacttaaaat aagtaaaaag tatgttattt taggttcgat ttttccaatt atggcattaa caaatactct tgtaattaga aaaaaattaa aagctttatt aggagagggt aaggttcaaa aaggactcaa

Sequence 4: agtagtgggt ggaatagtgt taactagcta agtagaaaac accgaacgaa ttaattctac gattaccgtg actgagttaa ctagctaaaa gaaaacgaag ctaaaagtga tgcgccccta agtacaggag ggggtgcttc ttctggaaca tttaataaat acctcaacac caagcaagcg ttagagagca tcggcatctt gtttgatggg gatggaatga ggaatgtggt tacccaactc

Sequence 5: ttttatttgt ttaatagtta aaaaaagcgt taactagcta atgcataaac gacatcgcta atgactgtct ttatgatgaa ttaactagct aatgggtcga tgtttgatgt tatggagcag caacgatgtt acgcagcagg gcagtcgccc taaaacaaag ttaaacatca tgttatgttt tatctatttt attagttaaa aaagttttga atttttatct atttttagtt aataaaagtc

Sequence 6: ggagggagat catcagatca aagtaataaa ttcaccaagt acctcaacac caagcaagca ttggaaagga tcggcatctt gtttgatggg gatggaatga ggaatgtggt tacccaactc taccaaccca acaaggtgaa aagtggtcaa tatcaacaaa ataacaccta caacaggtta attgagcctg acaatgcaac aagtgcagcg agcagcatga ccagcttgtt aaagctgttg

4 TrackBacks

Entry TrackBack URL: http://pandasthumb.org/cgi-bin/mt/mt-tb.fcgi/3519.

Intelligently Designed DNA from A Blog Around The Clock on January 31, 2008 1:35 PM

Someone did it. Get a prize if you correctly identify which one is intelligently designed. In both cases, the designer was an intelligent.....human. Of course. No media reports yet of bioengineering labs run by chimps, dogs, elephants or dolphins.... Read More

moar cute puppy pictures Read More

Determining where a genome has been produced or altered by an intelligent designer is a matter of some importance. Consider the claims that the HIV virus was engineered as a biowarfare weapon, or the concern that virulence genes from other... Read More

A new RSS feed of reader-selected ScienceBlogs posts. Read More

42 Comments

Craig Venter groupie. The answers to your questions, as you state them, can be obtained with just Blast. Haven’t the foggiest idea about algorithms. 1, 5, and 6 are Synthetic Mycoplasma genitalium. 1 is a membrane G protein coupled receptor, 5 is an aminoglycoside-3:adenyltransferase, and 6 is an adhesion protein.

Designed by Craig Venter? Snoot. Designed by natural selection and copied by Craig Venter. I can use the program.

Sorry. “Snoot” should read “snort”, or maybe LOL, or Ha, or some other derision of Craig Venter’s sense of self importance, and scientific creationist’s deceptiveness.

I’m a researcher. I really need the program.

If Mike is right, and he sounds pretty convincing to me, then I was way off.

I based my guess on looking at the sequences themselves, and assuming that any human designer would be lazy and use the minimum of steps. For instance, coding for leucine can be done with CTT or CTA. In this instance, it’s easier to use the former, since adding another ‘T’ after ‘CT’ is presumably easier than adding an ‘A’, since the ‘T’s are already right there. This means that human designed sequences would have more repeated letters overall.

Of the 6 sequences, 5 of them have 70 +/1 10% repeats. The only one outside this is sequence 3, with 91. Therefore I would have said only sequence 3 was the artificial one.

I used the same methodology as Mike, i.e. simple blast searches, and would say that it was samples 1,4,5 and 6.

1, 4 and 5 are easiest to identify since they have ‘watermarks’ in reading frames of ‘CRAIGVENTER’, ‘VENTERINSTITVTE’ and ‘CINDIANDCLYDE’. 6 only seems to have some transposon insertion sites to show its origins.

The watermarks definitely seem to constitute a significant signal.

Sequence 1: Intelligently designed. When translated it reads (reading frame 1): IITKWCDLINSTTCLTS*CRAIGVENTERLTS*FF*LDGNCWNSQLFSWNFS*SSNT*NK *KVCYFRFDFSNYGINKYSC

Sequence 4: Possibly. Reading frame 2 gives: VVGGIVLTS*VENTERINSTITVTELTS*KKTKLKVMRP*VQEGVLLLEHLINTSTPSKR *RASASCLMGME*GMWLPN

Sequence 5: Possibly. Reading frame 3 gives: LFV**LKKALTS*CINDIANDCLYDELTS*WVDV*CYGAATMLRSRAVALKQS*TSCYVL SILLVKKVLNFYLFLVNKS Possibly Cindi Pfannkoch and Clyde Hutchison who worked with Dr Venter. Defining a minimal cellular genome (online pdf)

Sequence 6: Possibly not intelligently designed. 100% homology with Synthetic Mycoplasma genitalium JCVI-1.0 from nucleotide 315115 till +-315300. However the sequence is homologous to a stretch of nucleotides in Mycoplasma genitalium G37 MgenG_01_3 26-265. and Mycoplasma genitalium G37 314744-314983.

Sequence 2: Not intelligently designed 100% homologous to Mycoplasma genitalium G37 168961-169200.

Sequence 3: Not intelligently designed: 100% homologous to Mycoplasma genitalium G37 84781-85020, and Mycoplasma genitalium G37 MgenG_01_3 48001-48240.

Final answer: Sequences 1, 4 and 5 are intelligently designed and the other sequences appear to naturally distributed in the Mycoplasma genitalium G37 strain of bacteria.

“Sequence 1: Intelligently designed.”

By no stretch of the imagination. The code is already there, produced by natural selection, in the Mycoplasma genome. The only intelligent design going on here is from the engineers and chemists in the employ of Craig Venter that makes the synthesis possible. “Synthetic” has a special meaning in DNA sequence databases. Anything cut and pasted has the label “synthetic”. The gene was not intelligently designed in that the sequence necessary for function has been produced by natural selection.

Have just put the kids to bed after rowdy birthday party. Off to bed now. Play nice and I’ll see you all in the morning.

Apologies for the lay out, hopefully this is better.

Sequence 1: Intelligently designed. When translated it reads reading frame 1): IITKWCDLINSTTCLTS*CRAIGVENTERLTS*FF*LDGNCWNSQLFSWNFS*SSNT*NK*KVCYFRFDFSNYGINK YSC

Sequence 4: Possibly designed. Reading frame 2 gives: VVGGIVLTS*VENTERINSTITVTELTS*KKTKLKVMRP*VQEGVLLLEHLINTSTPSKR*RASASCLMGME*GMW LPN

Sequence 5: Possibly designed. Reading frame 3 gives: LFV**LKKALTS*CINDIANDCLYDELTS*WVDV*CYGAATMLRSRAVALKQS*TSCYVLSILLVKKVLNFYLFLV NKS Possibly Cindi Pfannkoch and Clyde Hutchison who worked with Dr Venter. Defining a minimal cellular genome (online pdf)

Sequence 6: Possibly not intelligently designed. 100% homology with Synthetic Mycoplasma genitalium JCVI-1.0 from nucleotide 315115 till +-315300. However the sequence is homologous to a stretch of nucleotides in Mycoplasma genitalium G37 MgenG_01_3 26-265. and Mycoplasma genitalium G37 314744-314983.

Sequence 2: Not intelligently designed. 100% homologous to Mycoplasma genitalium G37 168961-169200.

Sequence 3: Not intelligently designed: 100% homologous to Mycoplasma genitalium G37 84781-85020, and Mycoplasma genitalium G37 MgenG_01_3 48001-48240.

Final answer: Sequences 1, 4 and 5 are intelligently designed and the other sequences appear to naturally distributed in the Mycoplasma genitalium G37 strain of bacteria.

Mike:

“Sequence 1: Intelligently designed.”

By no stretch of the imagination. The code is already there, produced by natural selection, in the Mycoplasma genome.

Even the bit that translates as CRAIGVENTER?

TTFN

“Even the bit that translates as CRAIGVENTER? “

Especially that bit. No function other than satisfying the ego of Craig Venter. This is intelligent?

Ok, I see my error. They’re all in the synthetic genome. Only looked at the first lines of the alignments at first. But inserting names isn’t making a functional protein. The most you can hope for is that you’ve made a neutral change to the protein’s tert structure. The only “intelligent designing” here is the engineering making very long DNA synthesis possible in vitro.

My other error was not reading Wired.

Remarkably, I thought almost the same thing Dave S. Though we look to have counted differently as I got;

SEQ1 = 76 repeats, SEQ2 = 66, SEQ3 = 92, SEQ4 = 70, SEQ5 = 78, SEQ6 = 70 (mean = 75.333, std. dev = 9.266).

Assuming a normal distribution of such pairs in the genome (it’s actually binomial, but with a very large N) Excel gave me the following probabilities for each score;

p(SEQ1) = 0.471, p(SEQ2) = 0.157, p(SEQ3) = 0.036, p(SEQ4) = 0.282, p(SEQ5) = 0.386, p(SEQ6) = 0.282

Only SEQ3 showed a significant deviation from the (group) mean, hence I would have fingered it for the designed sequence.

Notes: 1. If truly independent, the population mean score on a length of 240 bases would be 60 (the probability of any base matching the next in the sequence is 1 in 4). 2. The test is really only looking for the ‘odd-man-out’, not for indications of design. 3. The theoretical basis for the test is best summed up as, “I can’t afford to spend more than 10 minutes on this, what can I check for?”

It’s interesting to reflect on how quickly I convinced myself from the flimsiest of evidence that SEQ3 was the designed one and became ‘enamoured’ of my own hypothesis. Perhaps it’s a good job I didn’t run my test on some of the published human genome data as I considered or I might have mailed my CV to the discovery Institute by now! ;-)

Ah bugger, I did not see the “To win, you have to” update.

Here goes.

1) Sequences 1, 4 and 5 are intelligently designed by Dr Craig Venter’s group (all humans I presume)

2) The virtual ribosome was used (http://www.cbs.dtu.dk/services/VirtualRibosome/) with all six reading frames. Sequence 1, 4 and 5 contained the following amino acid sequences.

Sequence 1: Reading frame 1 of the original sequence: GTAGAAAACACCGAACGAATTAATTCTACGATTACC = CRAIGVENTER

Sequence 4: Reading frame 2 of the original sequence: GTAGAAAACACCGAACGAATTAATTCTACGATTACC = VENTERINSTIT

Sequence 5: Reading frame 3 of the original sequence: TGCATAAACGACATCGCTAATGACTGTCTTTATGATGAA = CINDIANDCLYDE

In order to make sure these amino acid sequences did not contain homologous, BLAST (http://www.ncbi.nlm.nih.gov/sutils/genom_tree.cgi) was used (Blastp) to look for similar sequences. None were found.

3) Sequence 1: TGTCGTGCAATTGGAGTAGAGAACACAGAACGA The sequence that was designed was inserted between a putative lipoprotein and a ptsG PTS system, glucose-specific IIABC component.

Sequence 4: GTAGAAAACACCGAACGAATTAATTCTACGATTACC The sequence that was designed was inserted between a metallo-beta-lactamase superfamily protein and an rRNA-16S ribosomal RNA.

Sequence 5: TGCATAAACGACATCGCTAATGACTGTCTTTATGATGAA The sequence that was designed was inserted between a putative lipoprotein and DNA polymerase III, alpha subunit.

None of the designed sequences appear to have any relationship to a functional protein. The other sequences have 100% homologies to naturally occurring organisms (see above). Hopefully this is it :).

Ian,

…it’s not ID’s task to ape your pathetic level of detail. ID is true because we are discovering discontiuities with intelligently designed systems all the time… :-)

Dave S. Wrote:

For instance, coding for leucine can be done with CTT or CTA. In this instance, it’s easier to use the former, since adding another ‘T’ after ‘CT’ is presumably easier than adding an ‘A’, since the ‘T’s are already right there. This means that human designed sequences would have more repeated letters overall.

I don’t see the connection. CTT and CTA use the same number of Ts and As, because the complement of CTT is GAA and the complement of CTA is GAT. It’s lazy inasmuch as it’s easier to type “CTT” than “CTA”, but once the sequence is in a cell, the chemistry won’t dictate what is easier or harder in this case.

I wanted to add about the “easier to type CTT than CTA” comment, when engineering a protein sequence, you have to keep in mind a concept called “codon bias” - the tendency of a particular organism to use certain codons to code for proteins than others. So you might actually want to choose CTA over CTT, or vice versa, depending on how Mycoplasma genitalium prefers its codons. So I don’t think such a criterion for detecting ‘design’ would pan out well.

I had a BLAST solving this one!

Isn’t any record or copy of anything “intelligently designed”?

After all, these are (a priori) low-probability sequences, and per the definition of CSI they “conform to an independently given pattern” – namely the actual DNA. Dembskyites should tell us that they are *all* intelligently designed.

And they would be correct, according to a strict notion of what ID means. (Surely typing the sequences in is an ID event!)

Not that that makes the whole thing any less vacuous…

Does any creationist claim to be able to identify an intelligently designed sequence? Who and where?

If you don’t know already Ian sent Dembski an email inviting him to partake in the challenge to identify the designer. Dembski posted Ian’s email on UD but of course the resident expert on design detection doesn’t seem to have any interest in demonstrating his awesome design detection skillz and methods. Instead he’s letting his cultists “debate” the issue.

The comments by the cultists at UD provide an interesting contrast to the comments left here at PT. Instead of attempting to detect the designer the UD cultists prefer to claim persecution and pretty much do anything but attempt to detect a designer.

Read it here:

http://www.uncommondescent.com/inte[…]n-challenge/

What can you say about folks who claim to be design experts have no interest in detecting design, even when they are given a list of 6 and told at least one was designed.

teleological, it seems as if you used two criteria to find what you are claiming are the designed sequences. One was simply that you saw something (names) that you recognized. The other was that you found disruptions in “natural” sequences. Put briefly, one was “it looks that way to teleological”, and the other was “doesn’t look like the product of RM+NS”.

Do you have any data that tells us that these methods are in fact reliable detectors of design in nature? Please, if you might, elaborate on both of your methods.

@ Mr_Christopher - Boy, they are sure “worked up” over there! :-)

“Please, if you might, elaborate on both of your methods.”

Hell’s bells, we found it by reading Wired. The creator told the prophet who wrote it in the good book. I missed it because I was blind materialist looking for a function I could explain. Even though I could see the gaps in the alignment that I couldn’t explain I ignored them. The creator’s in the gaps.

I like Casey “Don’t Show My Face” Luskin’s answer the best.

They are ALL designed!

Too funny. I also like how Luskin explains Dembski’s methods for design detection while Dembski says not a word. Luskin has now been promoted Dembski’s UD spokesperson and resident lap poodle. Not bad for a lawyer (in “good standing” in the State of California no less).

I do love the ID cult!

Since for ID-creationist all the sequences are designed a better challenge would be the detection of undesigned sequences in genome projects that are due to sequencing errors caused by polymerases and thus occur unintentional. Of course the use of BLAST, fasta etc comparisons with sequences of other species should be prohibited.

@ Dave S and David B:

For chemical DNA synthesis, having repeated bases does not help you. The bases have to be added one at a time anyway. The nucleotide units come with a protective “cap”, which stops the DNA from extending, and must be removed in a separate chemical step. The cycle looks kinda like this:

GATTAC -> add base A* (with cap) -> GATTACA* -> remove leftover A*, then react to remove cap -> GATTACA -> etc.

Without the cap, you’d wind up with GATTACAAAAAAAAAAAAAAAAAAA, since addition would get out of hand.

Repeated bases are important in certain kinds of sequencing, though, where all the bases in a repeat do get read at once. There’s sequencing-by-synthesis, where you have DNA copying itself the old-fashioned way…except you only give it one type of base at a time, and there is a flash of light every time a base is added. So if you’re trying to copy GATTACA, and you’re at GA, adding T will produce a double flash. This is a real technical problem, not so much for 1 vs. 2, but when you need it for, say, 15 vs. 16 bases.

Can someone tell me what the quote below means in simple terms..I copied it from the ID website. Thanks.

“IF (big if) Ian really wanted to refute ID all he has to do is to demonstrate that stochastic processes can account for living organisms and the IC structures they contain.

THAT would be a challenge- for ID to stay unfazed in the light of such data.”

As others already said, multiple of the sequences are part of the M.genitalium synthetic genome (seq 1,4,5,6) and are watermarked in the regions between opening reading frames. Sequence 5 however has vector sequences used to stitch the engineered sequences together.

So, I vote for sequence 5 as the most obvious giveaway of human/intelligently designed. I BLASTed. If you also used BLAST, you’ll notice that this one does not match the non-synthetic M.genitalium sequence. Vector sequences in a genome would be a red flag thats its possibly recombinant/transgenic/synthetic (pick one) since you can only synthesize pieces of DNA so large before you have to start stitching them together with good old fashioned molecular biology. And the sequence appears to be an integration site between two opening reading frames in one of the vectors used for engineering (Gateway binary vector R4pGWB540?).

Hey! You stole my idea!

Yes, an ID supported ran away without answering after claiming he could detect design because he was an engineer. HA HA!

Don

Bill,

Allow me to translate:

I will never believe any conclusion of science and I will always demand unreasonable proof for any claim made by science. I will never accept any scientific evidence since I already know the answer and don’t need to test it. No,I’m not a scientist, but I play one in church when preaching to the choir.

Just for the record, it has already been demonstrated that IC cannot be defined or measured but that very complex structures can indeed be produced by random mutations and natural selection. All of Behe’s pet examples have already been demolished. Nonsense like this just means that some people will never be satisfied with any “pathetic level of detail” provided, unless of course you confirm their most deeply held misconceptions.

I vote for whichever one reads “Paul Is Dead” when read backwards.

Sequence number two is clearly designed because with using the proper one-time cyptology pad, it contains the sequence “PROF*STEVE*STEVE*WAS*HERE”.

I think it’s number 4. I arrived at that by glancing at them and then guessing.

I should win because this mimics perfectly the reasoning behind ID “theory”.

According to Dembski, isn’t the use of BLAST programs and finding words/names examples of ‘side information’ - something that SHOULD NOT BE USED, since we couldn’t be sure of the motives/abilities of the Designer ?

If no one KNEW who CRAIGVENTER was, would the fact that THAT sequence of letters showed up mean anything (from a protein standpoint, it looks like a standard hydrophilic region, given the number of charged and hydrophilic residues) ?

What if the Designer’s name was ‘FLIVVVLLVELVIS’, working at the ‘AAVAAATHALLGVLS’ Institute from Procyon 6 ? Would anybody figure that out ?

That’s a flaw of ‘intelligent’ design - no standards but personal whimsy.

Now - can anyone figure out which sequence(s) are designed without recourse to any external background data (like the names of scientists, Institute names, etc) ? This is the hurdle that IDiots proclaim they have overcome, but don’t seem forthcoming with the details as to how .…

(BTW - what is with this system ? Every time I preview, it keeps reporting something like :

Syntax Error: mismatched tag at line 9, column 112, byte 792 at /usr/local/lib/perl5/site_perl/5.8.8/mach/XML/Parser.pm line 187 ?)

prof weird:

According to Dembski, isn’t the use of BLAST programs and finding words/names examples of ‘side information’ - something that SHOULD NOT BE USED, since we couldn’t be sure of the motives/abilities of the Designer ?

If no one KNEW who CRAIGVENTER was, would the fact that THAT sequence of letters showed up mean anything (from a protein standpoint, it looks like a standard hydrophilic region, given the number of charged and hydrophilic residues) ?

What if the Designer’s name was ‘FLIVVVLLVELVIS’, working at the ‘AAVAAATHALLGVLS’ Instite from Procyon 6 ? Would anybody figure that out ?

That’s a flaw of ‘intelligent’ design - no standards but personal whimsy.

Now - can anyone figure out which sequence(s) are designed without recourse to any external background data (like the names of scientists, Institute names, etc) ? This is the hurdle that IDiots proclaim they have overcome, but don’t seem forthcoming with the details as to how .…

(BTW - what is with this system ? Every time I preview, it keeps reporting something like :

Syntax Error: mismatched tag at line 9, column 112, byte 792 at /usr/local/lib/perl5/site_perl/5.8.8/mach/XML/Parser.pm line 187 ?)

You were mixing cases in your html tags; it doesn’t seem to like things like [B]this[/b] (substituting square brackets for angle brackets, of course).

You can figure out what’s designed, in this special case, by using frequency tables - the occurrence of a given n-letter string has a much different probability depending on whether it’s English vs. protein sequence vs. frame-shifted gibberish. It works pretty well, and requires no further info. The designed regions are short, though, so you get false positives like “ALES” and “SEEN” which score about as high on Englishness as “CRAIGVENTER”.

You could use the same trick if you wanted to tell if the sequence was mycoplasma vs. some other critter, but the magnitude of difference would be much smaller.

I don’t know if identifying some name is really the ID test, though. As far as I know, there was no dude named CRAIGVENTER in the Bible, so there’s nothing special about that sequence. It just evolved in language rather than biology. Recognizing that it’s not descended from anything known, and just poofed itself into existence - now that’s a test. (And one this sequence passes, if you only count biology.)

I’d also defend BLAST as a design detection tool. Human designs, anyway. Right now, we aren’t good enough to design from scratch - we take what nature has given us, figure out how it works, and shuffle the parts to make something we want. And even that is hard. BLAST can tell us if there has been recent DNA transfer from another lineage, which is a prime indicator that somebody put it there, and what those pieces are likely to do. (Like #5 here, which is a vector origin swiped from E. coli.) It’s darn useful if you want to figure out what a bioterrorist has been up to.

“A method that could reliably detect the action of human intelligent design in the genomes of microorganisms would be of significant advantage.”

Indeed, now that humans can alter DNA, how will you know if a newly discovered species was designed by humans or just eveolved?

eveolved…that is one cool word, typo or ‘by design’.

G’Day All

Sorry for not showing up. I’m pretty crook at the moment though. We do have a winner(s) and I will discuss this in a separate post later (and contact the winner(s) later). Now, I’m going to crawl under a rock until I feel better (and I missed the occultation as well bleah!)

Ian Musgrave:

I’m … crook at the moment though.

What did you steal?

;-)

Crook, as in sick as a proverbial (it’s Aussie slang). I have antibiotics to fight the evil bacteria that have taken over my inner ear, but I’m not capable of long term coherent thought at the moment. You will have to wait until tomorrow for me to post the final thoughts and organise the winner(s) prizes. Back to bed.

Okay, as we have a winner(s), I’m turning comments off here. Discussion can be continued at The Intelligent Design Challenge - Denouement where I discuss the aftermath of the challenge.

About this Entry

This page contains a single entry by Ian Musgrave published on January 31, 2008 3:52 AM.

Reason And Common Ground was the previous entry in this blog.

Teach the controversy? Or when ID expells... A case of missing links is the next entry in this blog.

Find recent content on the main index or look in the archives to find all content.

Archives

Powered by Movable Type 4.15b4b-en

Site Meter